Intan Syahirah, Amran (2016) Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR. [Final Year Project Report] (Unpublished)
PDF (Please get the password by email to repository@unimas.my , or call ext: 082-583914/3973/3933)
Intan Syahirah.pdf Restricted to Registered users only Download (3MB) |
Abstract
Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Southeast Asia, including Malaysia. The aim of this study was to evaluate molecular typing of Leptospira spp. by using Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) as a tool. A total of 70 samples were obtained from the culture collection in Microbiology Laboratory FRST, UNIMAS. The samples was cultured into semi solid EMJH media added with 5-fluorouracil. The cultures were incubated at room temperature (28-30°C) for 30 days before ERIC-PCR was conducted. This procedure was used a specific primer which is ERIC 1 (ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) that targeting ERIC sequence. The ERIC elements were used as a genetic marker to characterize isolates within bacterial species. Though, by using PyElph 1.4 software to construct the phylogenetic tree to know the similarity coefficient levels and calculating by using DI (Diversity Indices'). From that, there are no proper arrangement of bacteria in the group regardless of samples type whether it mix together to 7 groups and also of Leptospira in different location and sources. In conclusion, genetic relatedness between Leptospira spp are studied and allow their characterization among the type of samples isolates.
Item Type: | Final Year Project Report |
---|---|
Additional Information: | Project Report (B.Sc.) -- Universiti Malaysia Sarawak, 2016. |
Uncontrolled Keywords: | Leptospira, ERIC-PCR, PyElph 1.4, Diversity Indices' and specific primer ERIC, unimas, university, universiti, Borneo, Malaysia, Sarawak, Kuching, Samarahan, ipta, education, undergraduate, research, Universiti Malaysia Sarawak |
Subjects: | Q Science > QR Microbiology |
Divisions: | Academic Faculties, Institutes and Centres > Faculty of Resource Science and Technology Faculties, Institutes, Centres > Faculty of Resource Science and Technology |
Depositing User: | Karen Kornalius |
Date Deposited: | 28 Feb 2017 02:48 |
Last Modified: | 11 Dec 2023 06:53 |
URI: | http://ir.unimas.my/id/eprint/15463 |
Actions (For repository members only: login required)
View Item |