Construction of a plant transformation vector carrying a marker gene for expression in plants

Ngien, Leh Nah. (2006) Construction of a plant transformation vector carrying a marker gene for expression in plants. [Final Year Project Report] (Unpublished)

Construction of a plant transformation vector...(24 pgs).pdf

Download (4MB) | Preview
[img] PDF (Please get the password from Digital Collection Development Unit, ext : 3932 / 3914)
Construction of a plant transformation vector...(fulltext).pdf
Restricted to Registered users only

Download (10MB)


The construction of plant Iransfonnalion vector, a binary vector is importam especially in plant transfonna tion involving Agrobaclenwn (ume/aciens. The resultaIll binary veClor is transfonne::d into AgJobaCferiflll1 lume!aclens as a carrier to be fun her transformed inla the plants. In this stud y, the transferred-DNA or T-DNA (-5.5 kb) originated from binary vector, pBl12l supplied by Arabidopsis Biologic31 Resource Center (Columbus) was PCR-amplified in order to be subcloned into pUCl9 vector. The complete sequence of pBl121 (Accession number: AF485783) was derived and primer designed for amplification of T-DNA and non-T-DNA regions. T-DNA was successfully PCR-amplified by using forward primer (5' -GCATATGTAGGTTTACCCGCCAATATATCCTGTCA -3') and reverse primer (5' -GCATATG AGGCAGGATATATTGTGGTGTAAACA -3'). Several h'ials with different subcloning strategies were carried out to subelone the PCR fi'agment (T-DNA) into pUCI9. The ligation reaction mixture was evemually transfonlled inlo E. coli strain JM 109. Less than 50% of white colonies were obselved by using adaptors wi th BamHI site which were added during ligation together with BamHI-cut pUCJ9. However, the gene cloning was failed as no insert was detected both with restriction enzyme and PCR analyses. The problem was mainly due to fuilure in ligation reaction. The work to form a helper plasmid from PCR-amplified non-T-DNA could not be carried out due to time constraint.

Item Type: Final Year Project Report
Additional Information: Project Report (B.Sc.) - Universiti Malaysia Sarawak, 2006.
Uncontrolled Keywords: plant trans formation vector, binary vector pBI121 , Agrobacterium tumejaciens. T-DNA , PCR, unimas, university, universiti, Borneo, Malaysia, Sarawak, Kuching, Samarahan, ipta, education, undergraduate, research, Universiti Malaysia Sarawak
Subjects: Q Science > QR Microbiology
Divisions: Academic Faculties, Institutes and Centres > Faculty of Resource Science and Technology
Depositing User: Saman
Date Deposited: 20 Mar 2018 04:51
Last Modified: 20 Mar 2018 04:53

Actions (For repository members only: login required)

View Item View Item