Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Jin-Ai M.A., Tan and Saw-Sian, Chin and Gek-Bee, Ong and Mohamed N., Mohamed Unni and Ashley E.R., Soosay and Henry R., Gudum and Siew-Leng, Kho and Kek-Heng, Chua and Jang J., Chen and Elizabeth, George (2015) Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations. Public Health Genomics, 18 (1). pp. 60-64. ISSN 1662-8063

[img]
Preview
PDF
NO 140 Transfusion-dependent Thalassemia in northern Sarawak - abstrak.pdf

Download (108kB) | Preview

Abstract

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Item Type: Article
Uncontrolled Keywords: Chinese · Malays · Gene mutations · Indigenous groups · Sarawak · Thalassemia, research, Universiti Malaysia Sarawak, unimas, university, universiti, Borneo, Malaysia, Sarawak, Kuching, Samarahan, ipta, education
Subjects: R Medicine > R Medicine (General)
Divisions: Academic Faculties, Institutes and Centres > Faculty of Medicine and Health Sciences
Depositing User: Karen Kornalius
Date Deposited: 28 Jul 2015 06:50
Last Modified: 06 Feb 2017 07:47
URI: http://ir.unimas.my/id/eprint/8402

Actions (For repository members only: login required)

View Item View Item